Adapter For 96 Well Pcr Plates

…enables much faster thermal transfer to the samples when compared to conventional PCR tubes or plates. The thermal cycling mechanism of GENECHECKER™ achieves extremely fast ramping rate for both heating and cooling. Environmentally friendly The technology enables an…

Features PCR plate adapters are designed to support thin-walled PCR plate wells during centrifugation Available for 96-well and 384-well PCR plates Adapters can be used in all Eppendorf plate rotors

…cyclers, this plate can be used directly in ABI ® 96 well instruments without the need for any adapters. The rigid FrameStar 2-component design eliminates warping and distortion during PCR, making it ideal for use with robotic systems. The semi-skirt allows for labeling or barcoding for sample…

…control accuracy of ±0.1°C (over 96 wells) and first-class heating rates of up to 8°C/sec. This combination makes the overall system the ultimate for any real-time PCR application. To guarantee the highest specificities for different assays, the device is available with…

…block formats. The Quick Block Exchange technology allows for an easy exchange of block modules. All blocks are made of aluminum and offer high ramp rates for fast protocol running times. Additionally, to achieve ultimate performance a 96 well block made of silver is available. Due to its excellent…

…plate-based systems as partial plates can be used and can be scaled up to a 24-well format with the appropriate magnetic stand. The streamlined protocol can be easily adapted on most robotic liquid handling platforms. Purified DNA is suitable for PCR, qPCR, restriction digestion, hybridization…

…Cryo-Adapter for Titer Plates: Extruded aluminum insert for 2210 Titer Plate. When inserted in titer plate and chilled in 2600 Cryo-Station, 2650 Cryo-Adapter keeps samples in titer plate cold during grinding, preserving RNA and proteins. Sold in pairs. 2660 Cryo-Block for 15 mL Polycarbonate…

…evaporation in PCR, reducing cross contamination Seals 96- and 384-well plates Integrated thermostat prevents overheating Improved mechanics for easier sealing PCR Plate Adapter included ? ? Eppendorf™ HeatSealer S200 Accessory, Plate Adapters For use…

…Plate Sealer is a compact, fixed temperature manual heat sealer for PCR plates and microplates. The MicroTS is Ideal for use in low to medium throughput laboratories where space is limited but speed and reliability is paramount. The MicroTS Microplate Sealer requires at least one adapter…

Adapters for the Ther-Mix and Flexi-Therm Vitl offers a range of interchangeable intelligent Heated Modules, used as adapters for the Flexi-Therm dry block heater and Ther-Mix heated laboratory mixer. Our Heated modules are a more efficient and accurate method of sample heating. They…

…procedure has been tested for isolating nucleic acids from COVID-19, Hepatitis A, Hepatitis C and HIV. The isolated RNA can be used for PCR, qRT-PCR and other downstream applications. This protocol is validated on Allsheng auto pure 96 and KingFisher plex and can be adapted to major automation…

By adapting Hi-Bind technology with 96-well plates, the E-Z 96® Tissue DNA Kit provides a high-throughput method to purify genomic DNA from whole blood, buccal swabs, mouse tail, rat tail, tissues and animal cells and tissues in a 96-well plate format. Purified DNA is suitable for most…

…to accept 96 x 0.2ml tubes, a 96 well plate or 39 x 0.5ml tubes all in the same sample block. An in-situ adapter is available for use with slides. Additionally, the unit may be purchased with a 384 well sample block. In situ adapter converts TC 9639 multi-format block for accommodate…

…well in less than 1 hour. The system combines the reversible nucleic acid-binding properties of the HiBind matrix with the speed and versatility of the E-Z 96® DNA plate to eliminate polysaccharides, phenolic compounds, and enzyme inhibitors from plant tissue lysates. Purified DNA is suitable for…

…PCR plate, the size of which is only 1/8 the size of a standard 96-well plate. The well format mirrors a 384-well plate therefore allowing the use of a 16-channel micropipette. The small plate cuts reagent costs in half whilst still producing a strong fluorescence signal. Minimizing the plate size…

…accommodate a variety of tubes from 200ul through 50ml. CoolSink™ plate holders accommodate 6-, 12-, 24-, 48-, and 96-well plates and 50ml reagent reservoirs. CoolRacks® are gray in color unless noted. Ideal for PCR, protein/nucleic acid handling, tissue freezing, cell culture, virus and…

…- (adapters not included) ITS3f (GCATCGATGAAGAACGCAGC, 20 bp), ITS4r (TCCTCCGCTTATTGATATGC, 20 bp). Required Equipment - Microcentrifuge, plate spinner (centrifuge), 96-well real-time quantitative PCR system (SYBR Green compatible) or standard PCR system, and 96-well real-time PCR plates. …