• PRODUCT AVAILABILITY: Did you know you can view a product's availability right on the product page? Simply enter the quantity you want to purchase and the current availability will appear below the item.

  • Product is restricted and can only be purchased by customers with a web profile linked to a Thomas Business Account - Click here to login or create your web profile. If you do not have a Thomas Business Account, please Contact Us and someone will respond with details on how to apply for a business account with us.

Cellomics Technology

Angiopoietin-1 (Angpt1) shRNA lentivirus

Not yet rated

NOTE: Due to special handling or shipping requirements, these products will have additional fees added during checkout. Click HERE for a description of what fees might be charged.

Angpt1 gene encodes a secreted glycoprotein called Angiopoietin 1 that activates the receptor by inducing its tyrosine phosphorylation. It appears to play a crucial role in mediating reciprocal interactions between the endothelium and surrounding matrix and mesenchyme. It may also mediate blood vessel maturation/stability, and may be involved in early development of the heart. Angiopoietin 1 is a member of angiopoietin proteins family that plays important roles in vascular development and regulation of angiogenesis. All angiopoietins bind with similar affinity to an endothelial cell-specific tyrosine-protein kinase receptor.

VirusAngiopoietin-1 (Angpt1) shRNA lentivirus
Titer (approx.)1 x 10CFU/ml
Vector InformationVector includes both 5' and 3' lentiviral LTR and all necessary elements for effective transduction; woodchuck hepatitis virus posttranscriptional regulatory element (WPRE)
Promotor for Target GeneU6
Target Gene / Reporter(s)Angiopoietin-1 (Angpt1)
SpeciesHuman
Construct IDshRNA TRCN0000058638
Other IdentifierNM_001146.3-917s1c1
SequenceCCGGCCCAGGTACTAAATCAAACTTCTCGAGAAGTTTGATTTAGTACCTGGGTTTTTG
Knockdown Efficiencyn/a
Selection GenePuromycin
Biosafety LevelBSL-2
ShippedDry ice
StorageStore at -80°C

Please Enter Your Order Info

Filter by:

  • Clear Filters
Product Detail
Thomas No.
C839R93
Mfr. No.
PLV-10103-50
Description
Angiopoietin-1 (Angpt1) shRNA lentivirus (2x25ul)
list price/quantitytotal
$0.00
Thomas No.
C839R94
Mfr. No.
PLV-10103-200
Description
Angiopoietin-1 (Angpt1) shRNA lentivirus (8x25ul)
list price/quantitytotal
$0.00
$0.00 (0 Items)
Product is restricted and can only be purchased by customers with a web profile linked to a Thomas Business Account - Click here to login or create your web profile. If you do not have a Thomas Business Account, please Contact Us and someone will respond with details on how to apply for a business account with us.

Write A Review